hot firepol multiplex mix ready to load (Solis BioDyne)
Solis BioDyne is a verified supplier 
Solis BioDyne manufactures this product 
94
Structured Review
Solis BioDyne
hot firepol multiplex mix ready to load
Hot Firepol Multiplex Mix Ready To Load, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hot+firepol+multiplex+mix/HOT+FIREPol+MultiPlex+Mix+Ready+To+Load/pm41932981-331-13-20
Average 94 stars, based on 7 article reviews
Hot Firepol Multiplex Mix Ready To Load, supplied by Solis BioDyne, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hot+firepol+multiplex+mix/HOT+FIREPol+MultiPlex+Mix+Ready+To+Load/pm41932981-331-13-20
Average 94 stars, based on 7 article reviews
hot firepol multiplex mix ready to load - by Bioz Stars,
2026-10
94/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: First Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001). .. Second Step PCR was done using Nextera XT Index v2 Primers (Illumina) and Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity Article Snippet: First Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001). .. Second Step PCR was done using Nextera XT Index v2 Primers (Illumina) and Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity Article Snippet: DNA was quantified by PreciseGreen (Lumiprobe, Catalog No. 12010). .. PCR primers (all 5’−3’ orientation) for TBC1D23 for HEK293 clonal lines (forward: ATTACCCAGTTGAGTGCATAGG, reverse: AATGCTGTGGAGGGTATAGCAG) for U2OS clonal lines (forward: TGGAAGCAGGAGGTTGTGAT, reverse: TCTAGATGCGGCATGCTCATAA) for AP1M1 for HEK293 clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) and for U2OS clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) + Illumina Tails was done using Article Title: Stable in vitro propagation of Fagus sylvatica using micro-cuttings established from seedlings Article Snippet: .. PCRs were conducted using Article Title: Characterization of Emerging Human Dirofilaria repens Infections, Estonia, 2023 Article Snippet: .. The PCR reactions were carried out in a volume of 20 μL, using Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: DNA was quantified by PreciseGreen (Lumiprobe, Catalog No. 12010). .. PCR primers (all 5’−3’ orientation) for TBC1D23 for HEK293 clonal lines (forward: ATTACCCAGTTGAGTGCATAGG, reverse: AATGCTGTGGAG GGTATAGCAG) for U2OS clonal lines (forward: TGGAAGCAGG AGGTTGTGAT, reverse: TCTAGATGCGGCATGCTCATAA) for AP1M1 for HEK293 clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) and for U2OS clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGG TATG) + Illumina Tails was done using Multiplex Assay:Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: First Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001). .. Second Step PCR was done using Nextera XT Index v2 Primers (Illumina) and Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity Article Snippet: First Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001). .. Second Step PCR was done using Nextera XT Index v2 Primers (Illumina) and Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity Article Snippet: DNA was quantified by PreciseGreen (Lumiprobe, Catalog No. 12010). .. PCR primers (all 5’−3’ orientation) for TBC1D23 for HEK293 clonal lines (forward: ATTACCCAGTTGAGTGCATAGG, reverse: AATGCTGTGGAGGGTATAGCAG) for U2OS clonal lines (forward: TGGAAGCAGGAGGTTGTGAT, reverse: TCTAGATGCGGCATGCTCATAA) for AP1M1 for HEK293 clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) and for U2OS clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) + Illumina Tails was done using Article Title: Stable in vitro propagation of Fagus sylvatica using micro-cuttings established from seedlings Article Snippet: .. PCRs were conducted using Article Title: Characterization of Emerging Human Dirofilaria repens Infections, Estonia, 2023 Article Snippet: .. The PCR reactions were carried out in a volume of 20 μL, using Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: DNA was quantified by PreciseGreen (Lumiprobe, Catalog No. 12010). .. PCR primers (all 5’−3’ orientation) for TBC1D23 for HEK293 clonal lines (forward: ATTACCCAGTTGAGTGCATAGG, reverse: AATGCTGTGGAG GGTATAGCAG) for U2OS clonal lines (forward: TGGAAGCAGG AGGTTGTGAT, reverse: TCTAGATGCGGCATGCTCATAA) for AP1M1 for HEK293 clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGGTATG) and for U2OS clonal lines (forward: CAGGATCTTCCAGGCAGCAG, reverse: CTGTAGGGTGGCCAGG TATG) + Illumina Tails was done using other:Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: First Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001). Article Title: A CRISPR/Cas9 screen reveals proteins at the endosome-Golgi interface that modulate cellular anti-sense oligonucleotide activity. Article Snippet: Second Step PCR products were purified using NGS Clean Beads (CleanNA, Catalog No. CNGS-0001), quantified using PreciseGreen (Lumiprobe, Catalog No. 12010) and equimolarly pooled. |